rs7847686 chr9:2394420 T>C
- Sequence
aactttatgtgattaatttaaaag[T/C]tttgatgaaattcatagaaatata
- ASB in cell types
- CLB-Ga (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CLB-Ga (neuroblastoma) | 1.93 | -1.56 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Spleen