rs78501028 chr8:143547871 T>C
- Sequence
atcctggctaacacggtgaaaccc[T/C]gtctctactaaaaacacaaaaaat
- ASB in cell types
- K562 (myelogenous leukemia) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN LMBL2_HUMAN RING2_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.50 | n/a | 1.33 | n/a | No Hit | |||
| LMBL2_HUMAN | 3.57 | n/a | 2.00 | n/a | n/a | |||
| RING2_HUMAN | 2.73 | n/a | 2.00 | n/a | n/a | |||
| ARI1B_HUMAN | 2.49 | n/a | 2.00 | n/a | n/a | |||
| KDM1A_HUMAN | 2.52 | -4.59 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood