rs78506 chr22:33018179 G>A
- Sequence
aggagccagacaggttagaaggcc[G/A]ttgtagtcattttggtccacagat
- ASB in cell types
- PC9 (lung adenocarcinoma) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | n/a | 3.20 | 3.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.85 | -0.03 | 1.00 |
Items per page:
1 – 2 of 2