rs7854524 chr9:113578046 A>G
- Sequence
gcatctcaactcaggaaagcggtc[A/G]gggctggcagagtggactgcgagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.10 | 0.33 | 1.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), cystatin c in serum, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood