rs78592190 chr1:15100551 T>A
- Sequence
tcgttccttctgcaaggctgccac[T/A]gtgtggcgagcagcggaatgacag
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) MDM(monocyte derived macrophages) GM02255 (Lymphoblastoid Cell Lines) erythroid progenitors
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.80 | -0.18 | 1.04 | n/a | n/a |
Items per page:
1 – 1 of 1