rs7866060 chr9:88532714 A>G
- Sequence
tttgagaccagcctggctaacatg[A/G]tgaaaccccgtctctactaaaaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.48 | -0.42 | 2.13 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 2.48 | -0.76 | 2.00 |
Items per page:
1 – 2 of 2