rs7868451 chr9:98225340 A>G
- Sequence
tcttgtggggccagtgctgcaggt[A/G]tggggacagataatggcttaatgg
- ASB in cell types
- TF-1 (erythroleukemia)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | n/a | 3.27 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hip bone mineral density (bmd), parkinsons disease, spine bone mineral density (bmd)
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid