rs7897530 chr10:32347043 G>C
- Sequence
cttgaggggcggagcgcagagccc[G/C]ccgtccgggcactaacaccagccg
- ASB in cell types
- breast tumor prostate gland Th1-cells SK-N-BE(2)-C (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.84 | -5.17 | 2.00 | |||
| prostate gland | -2.34 | 2.29 | 1.00 | |||
| Th1-cells | 1.58 | -0.63 | 1.00 | |||
| SK-N-BE(2)-C (neuroblastoma) | -1.20 | 1.93 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood