rs7898026 chr10:48289891 C>T
- Sequence
acctcctaaaatgtgaaattcagc[C/T]gcagtccttctgtcagagtgacct
- ASB in cell types
- foreskin keratinocyte KMS-11 (Plasma cell myeloma) right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.78 | n/a | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -2.29 | 1.42 | 2.00 | |||
| right lobe of liver | 1.75 | -1.49 | 1.00 |
Items per page:
1 – 3 of 3