rs78984491 chr10:126749271 C>T
- Sequence
tttttcctgcgctgcgcaattgta[C/T]gctcctcctacctgccccatggaa
- ASB in cell types
- CD34+ hematopoietic stem cells epidermal keratinocytes HMF (human mammary fibroblasts) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 2.34 | n/a | 2.50 | |||
| epidermal keratinocytes | 2.56 | 0.57 | 2.00 | |||
| HMF (human mammary fibroblasts) | 2.07 | -1.50 | 1.00 | |||
| foreskin keratinocyte | 0.58 | n/a | 2.83 |
Items per page:
1 – 4 of 4