rs7904249 chr10:79127580 G>A
- Sequence
agtgggctggggcggggtggggag[G/A]tgggtggcgttttccagaggggga
- ASB in cell types
- HL-60 (acute myeloid leukemia) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- INT13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT13_HUMAN | 2.38 | -2.07 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1