rs79079879 chr3:15332823 C>A
- Sequence
cgcaagcctcccgctttcgggagt[C/A]ccctcctccagccctcctccgagg
- ASB in cell types
- HEK293 (embryonic kidney) primary B-CLL cells IPSC-derived bipolar neuron bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.20 | 0.94 | 1.07 | n/a | No Hit | |||
| BRD4_HUMAN | 1.64 | -0.40 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2