rs7912230 chr10:86939675 A>C
- Sequence
gttccgccgcagagagagaccccc[A/C]ccccaacccagccttgcgcctgac
- ASB in cell types
- glioblastoma patient-derived cell model GM02630 (Fanconi anemi) RH4 (alveolar rhabdomyosarcoma) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG2_HUMAN | 1.90 | 0.28 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Sigmoid, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid