rs7926298 chr11:35337410 A>G
- Sequence
tttggtaatctttgtgtaaaacag[A/G]catctgagtcatctcagcagcagg
- ASB in cell types
- HCT-116 (colon carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.44 | 1.23 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.40 | 0.89 | 1.06 |
Items per page:
1 – 2 of 2