rs79298 chr22:50030504 G>T
- Sequence
cgcagcacaggctccagcgggtgc[G/T]catttagctggtttggatcccagc
- ASB in cell types
- GM17942 (lymphoblastoid cell) CD14+ monocytes CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.77 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, ldl cholesterol, longstanding arthritis, obesity with early age of onset (age >2), schizophrenia