rs7947006 chr11:27472800 A>G
- Sequence
agggttgcacgctctggttcccaa[A/G]cccccggccgctggcttatgcaaa
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -5.64 | 3.30 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg