rs7949405 chr11:17063645 A>C
- Sequence
agggccagtgccctggggacctct[A/C]ctctagggcctgcctctctccacc
- ASB in cell types
- foreskin keratinocyte MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) GBM39 (Human brain tumor) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CDN1B_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDN1B_HUMAN | 0.15 | 1.92 | 2.00 | n/a | n/a | |||
| JUN_HUMAN | 0.49 | 1.63 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, breast cancer, comorbid depressive syndrome and alcohol dependence, eicosapentanoic acid, height, schizophrenia, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood