rs79536510 chr7:154055705 T>C
- Sequence
gccgctacttcggtgggagctgtc[T/C]gaggtgctgaaaccttctcttggc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) SAH (induced pluripotent stem cell line) PFSK1 (primitive neuroectodermal tumor)
- ASB for transcription factors
- SMCA4_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 2.92 | -2.41 | 1.00 | n/a | n/a | |||
| SMRC1_HUMAN | 2.61 | -1.06 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2