rs7954275 chr12:31751576 T>C
- Sequence
aaatataatggggtgactcacatc[T/C]gtaatcccagcactttgtgaggct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.52 | 1.07 | 1.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Heart_Atrial_Appendage, Spleen, Whole_Blood