rs7954903 chr12:71371271 T>C
- Sequence
gaccacacacacccatcaaaacca[T/C]agtggtttgtgggctgtctaaaac
- ASB in cell types
- foreskin keratinocyte LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.83 | 2.46 | 2.25 | |||
| LNCaP (prostate carcinoma) | -0.26 | 1.85 | 1.00 |
Items per page:
1 – 2 of 2