rs7960653 chr12:19589121 C>T
- Sequence
aggcgcaattttaagtccttcctg[C/T]gtcactaaccatgaatgtggtctt
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | n/a | 2.40 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, infant head circumference, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), triglycerides change with statins