rs7962363 chr12:38905901 C>T
- Sequence
cctgatggagaaggtggcaccaga[C/T]gcagacccctaccgtccaggaccg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.25 | 0.92 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.45 | 0.78 | 1.07 | |||
| iPS-derived dermal fibroblasts | 2.27 | 1.05 | 1.00 |
Items per page:
1 – 3 of 3