rs7967778 chr12:102702719 G>A
- Sequence
tattatgtggggggaagcataccc[G/A]ccccctggtggctgatttacacat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neural progenitors IPSC-derived bipolar neuron LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.24 | 0.37 | 1.96 | -4.22 | Concordant | |||
| STAG1_HUMAN | 2.04 | n/a | 3.83 | n/a | n/a | |||
| SMC1A_HUMAN | 2.49 | -2.03 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP birth weight, college completion, fasting blood glucose, obesity with early age of onset (age >2), waist hip ratio