rs7975122 chr12:123458667 T>C
- Sequence
tggagtgcagtggtgcgatctcgg[T/C]tcactgcaacctccgcctcctggg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.29 | 0.86 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.15 | 0.81 | 2.02 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.06 | -2.03 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.30 | -0.68 | 1.00 | |||
| tibial nerve | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid