rs7979816 chr12:109539581 G>A
- Sequence
cagcacccaccatgcagtcttgcc[G/A]tgaaccacagagaaatgggctgaa
- ASB in cell types
- MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- JUN_HUMAN CDN1B_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.30 | 0.72 | 1.13 | n/a | No Hit | |||
| CDN1B_HUMAN | 1.58 | 0.38 | 1.00 | n/a | n/a | |||
| TF65_HUMAN | 1.77 | -0.80 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), chronic kidney disease, fasting blood glucose, hdl cholesterol, hypertension, mitral annular calcium, parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Colon_Transverse, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood