rs798975 chr13:32165027 G>A
- Sequence
cttcacattcaaagaacatacacc[G/A]tgctatacaatgcatttcatatac
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.25 | -1.37 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), fasting insulin, hdl cholesterol, mitral annular calcium, triglycerides