rs7995619 chr13:102580729 G>T
- Sequence
gtaggatgagtctagacaagatac[G/T]ggcttgtaaagaaggaattcaacc
- ASB in cell types
- VCaP (prostate carcinoma) Jurkat (T-cells) neutrophils from periferal blood ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.93 | -1.09 | 3.00 | |||
| Jurkat (T-cells) | 2.54 | 0.65 | 1.00 | |||
| neutrophils from periferal blood | 1.21 | -0.06 | 1.50 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 0.84 | -0.62 | 1.00 | |||
| adult erythroblasts | 2.21 | -1.47 | 2.00 |
Items per page:
1 – 5 of 5