rs79962857 chr2:9142888 C>T
- Sequence
tccttcctcggggcgcagcatcga[C/T]attcgccaccagggggtgctgccg
- ASB in cell types
- liver erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 3.11 | n/a | 2.00 | |||
| erythroid progenitors | 2.10 | n/a | 2.50 |
Items per page:
1 – 2 of 2