rs79963079 chr19:48322041 A>C
- Sequence
gccacgccccctctggttacaccc[A/C]ctcgctctgtaaggcacgccccct
- ASB in cell types
- HL-60 (acute myeloid leukemia) RCC4 (kidney cancer cell line) MOLT-4 (Adult T acute lymphoblastic leukemia) ME-1 (acute myeloid leukemia )
- ASB for transcription factors
- INT13_HUMAN NAB2_HUMAN HIF1A_HUMAN CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT13_HUMAN | 1.42 | 0.04 | 1.00 | n/a | n/a | |||
| NAB2_HUMAN | 2.59 | -2.29 | 1.00 | n/a | n/a | |||
| HIF1A_HUMAN | 1.78 | 0.16 | 1.50 | n/a | No Hit | |||
| CDK9_HUMAN | 1.37 | 0.63 | 1.00 | n/a | n/a | |||
| GATA2_HUMAN | 1.60 | -0.71 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood