rs80071272 chr9:110217824 C>A
- Sequence
aaaatccatcttaaatgtaagttt[C/A]ctgccctctagtggggactttgag
- ASB in cell types
- HMEC (human mammary epithelial cells) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 1.60 | -0.44 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.11 | -4.57 | 2.00 |
Items per page:
1 – 2 of 2