rs8013496 chr14:73951095 G>C
- Sequence
actgtagcctcaacctccctggct[G/C]aattgatcctcctgcctctgcctc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 2.97 | -2.95 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | -2.72 | 2.97 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.44 | -0.43 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood