rs8023681 chr15:88604862 A>G
- Sequence
gcggctcctggggggaagcaaagt[A/G]ccggcagctgggtggtgaggggct
- ASB in cell types
- GM23248
- ASB for transcription factors
- ZFHX2_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | -1.94 | 2.72 | 2.00 | n/a | n/a | |||
| EZH2_HUMAN | 1.52 | 0.85 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Testis, Thyroid