rs80279117 chr2:44343090 A>G
- Sequence
acagtgattgtaagtcatcattgt[A/G]taatatgcaccatgattttaaagg
- ASB in cell types
- thyroid gland gastrocnemius medialis heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | -2.56 | 2.48 | 1.00 | |||
| gastrocnemius medialis | n/a | 2.40 | 1.00 | |||
| heart left ventricle | -1.44 | 1.77 | 1.00 |
Items per page:
1 – 3 of 3