rs80310401 chr5:122492912 G>A
- Sequence
ttgtaaggcttggcaacatttttc[G/A]ttgctacaactagagtgggtgcta
- ASB in cell types
- Peyer's patch epithelial cell of prostate GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.55 | 0.17 | 1.31 | n/a | No Hit | |||
| STAG1_HUMAN | 1.77 | 0.27 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Esophagus_Mucosa, Lung, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Vagina