rs8034284 chr15:98953019 C>T
- Sequence
ggttctagcatgggagttctgttg[C/T]tacaagacatgaaagaatggcctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPT5H_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | -1.26 | 2.35 | 1.00 | n/a | n/a | |||
| MEF2B_HUMAN | 0.56 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, age at death with kuru exposure, height, nicotine dependence (smoking), obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, stabilized warfarin dose
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood