rs8049432 chr16:17556816 T>G
- Sequence
aagggacagggttatcatttcatg[T/G]cctggggcacatggagccatagac
- ASB in cell types
- foreskin keratinocyte MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.13 | 0.52 | 1.11 | |||
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | n/a | 2.11 | 2.50 |
Items per page:
1 – 2 of 2