rs8058292 chr16:12455502 C>A
- Sequence
gccctggccaaggaagtcctcttt[C/A]tccccacattagccagtgttcctt
- ASB in cell types
- THP-1 (acute monocytic leukemia) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.56 | 0.79 | 1.04 | |||
| HMEC (human mammary epithelial cells) | 0.86 | 1.65 | 1.17 |
Items per page:
1 – 2 of 2