rs8064629 chr17:82914518 T>C
- Sequence
atgagtgtgtttgctggagtgcgg[T/C]gtttgcactccctcacaccgctga
- ASB in cell types
- pancreas glioblastoma cells tibial nerve thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 1.89 | -1.54 | 1.00 | |||
| glioblastoma cells | 2.85 | n/a | 2.00 | |||
| tibial nerve | 1.70 | -1.01 | 1.00 | |||
| thyroid gland | -1.31 | 1.77 | 1.25 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid