rs8070845 chr17:74199846 G>T
- Sequence
cccagggcgggccttgcctgagag[G/T]tgcgggttggagctttgcgaatca
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) RCC 7860 (Renal cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.13 | -0.47 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.57 | 1.64 | 1.00 | |||
| RCC 7860 (Renal cell carcinoma) | -3.09 | 1.87 | 1.50 |
Items per page:
1 – 3 of 3