rs8072593 chr17:13114681 T>A
- Sequence
cctcggtgttgagcagtttcgccg[T/A]gaggccaggagagggcgggctgcc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) spleen stomach
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -1.76 | 1.72 | 1.00 | |||
| spleen | -2.08 | 2.45 | 1.00 | |||
| stomach | 1.67 | -1.44 | 1.00 |
Items per page:
1 – 3 of 3