rs8083569 chr18:63518699 G>A
- Sequence
cagttgctacagcttttctttaag[G/A]tctgtgaactcccgccctgcctta
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 0.63 | n/a | 1.50 | |||
| bipolar neuron | 2.57 | 0.27 | 1.00 |
Items per page:
1 – 2 of 2