rs808361 chr6:15880147 G>A
- Sequence
cccacccagggcatccggttgagc[G/A]gcaccagatgtgctttcctggccg
- ASB for transcription factors
- LYL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LYL1_HUMAN | -2.13 | 2.27 | 1.00 | -1.71 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting blood glucose, ldl cholesterol change with statins, salmonella-induced pyroptosis, total cholesterol change with statins