rs8094017 chr18:8882681 G>A
- Sequence
gagcttgggttattcccatactga[G/A]gaatcatttctcacccctgaggct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- IKZF1_HUMAN STAG1_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 3.92 | n/a | 1.17 | n/a | No Hit | |||
| STAG1_HUMAN | 0.62 | 1.15 | 1.04 | n/a | n/a | |||
| NFIC_HUMAN | -2.29 | 2.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, alzheimers disease, comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir, hypertension (early onset hypertension)