rs8102476 chr19:38244973 C>T
- Sequence
ctgcaggcagaggcaatgtggcca[C/T]gggtcatggaggggccggtaggtg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.17 | 0.77 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP esophageal squamous cell carcinoma (esophageal cancer), hdl cholesterol, hip bone mineral density (bmd), prostate cancer, prostate cancer (advanced prostate cancer), prostate cancer aggressiveness
PheWAS abnormal serum enzyme levels, actinic keratosis, acute reaction to stress, adjustment reaction, alcohol-related disorders, alcoholism, alzheimers disease, bacterial pneumonia, benign neoplasm of eye, calculus of kidney, chronic lymphoid leukemia, cirrhosis of liver without mention of alcohol, conduct disorders, congenital anomalies of great vessels, convulsions, degenerative disease of the spinal cord, delirium dementia and amnestic disorders, dementias, derangement of joint, non-traumatic, diseases of blood and blood-forming organs, disorders of function of stomach, disorders of synovium, tendon, and bursa, disorders of uterus, nec, disturbance of skin sensation, dyspepsia and disorders of function of stomach, epilepsy, epilepsy, recurrent seizures, convulsions, fracture of lower limb, genu valgum or varum (acquired), gram positive septicemia, impaction of intestine, intracranial hemorrhage, lymphoid leukemia, malaise and fatigue, muscular wasting and disuse atrophy, neck pain, non-melanoma skin cancer, nonrheumatic aortic valve disorders, open wound of eye or eyelid, open wound of lip and mouth, osteoarthrosis, osteoarthrosis, localized, secondary, osteoporosis, osteoporosis, nos or other, osteoporosis, osteopenia, & pathological fractures, other disorders of tympanic membrane, other infectious diseases, other peripheral nerve disorders, ovarian dysfunction, pain in joint, parkinsons disease, partial epilepsy, patellar fracture, pathologic fracture of vertebrae, perforation of tympanic membrane, persistent mental disorders due to other conditions, phosphorus metabolism disorder, polycystic ovaries, precordial pain, retinoschisis and retinal cysts, rhabdomyolysis, scleritis and episcleritis, septicemia, skin cancer, stress fracture, symptoms and disorders of the joints, symptoms involving digestive system, synoviopathy, testicular dysfunction, testicular hypofunction, urethritis and urethral syndrome, urinary tract infection, vascular complications of surgery and medical procedures
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Thyroid, Uterus, Vagina, Whole_Blood