rs8105338 chr19:46513644 C>T
- Sequence
tagccagcggtcctgcagcgcccc[C/T]tggtggggaacacgagcgcgtcgc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) epithelial cell of prostate FT282 (normal human fallopian tube tissue) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.98 | -0.31 | 1.72 | -8.38 | Concordant | |||
| STAG1_HUMAN | 2.41 | -2.83 | 3.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
