rs8109089 chr19:15113454 G>C
- Sequence
agctctgccagtgaaaacctgaaa[G/C]ggtcgaaggccgctttccacaggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | n/a | 2.95 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis