rs817384 chr20:63909914 A>C
- Sequence
ggtagaagaccagcaagcagcatg[A/C]cctcgtggttactgatcttatgaa
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) foreskin keratinocyte GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.00 | 0.49 | 1.14 | n/a | n/a | |||
| CTCF_HUMAN | 1.01 | 0.66 | 1.76 | 0.39 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
