rs8190582 chr10:26214806 A>T
- Sequence
accacccgggctcccacagcctgg[A/T]acagacttcacctagcacgctcag
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | -0.63 | 1.79 | 1.00 |
Items per page:
1 – 1 of 1