rs820148 chr17:75619807 A>G
- Sequence
attctctgctcatacaggtgcgct[A/G]gcccacgaccctgggctagaggtg
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SU-DHL-2 (anaplastic large cell lymphoma) | n/a | 3.06 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), infant head circumference
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Pituitary, Spleen, Testis, Thyroid, Whole_Blood