rs822373 chr3:186753397 A>G
- Sequence
ggtgaaggtcttaatgggaagccc[A/G]tggccgctgggagaatgtgtttct
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) T47D (invasive ductal carcinoma) glioblastoma cells
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.43 | 0.98 | 1.69 | n/a | No Hit | |||
| STAG1_HUMAN | -0.46 | 1.75 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, adiponectin levels, asthma, primary rhegmatogenous retinal detachment, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio